PriMicro Database

For classification, identification and molecular phylogenetic analyses of microbes

Primer Detail

Primer name
COXF4N
Gene name
mitochondrially encoded cytochrome oxidase I genes (cox1)
Primer sequence (5'-3')
GTATTTCTTCTTTATTAGGTGC
Direction
F
Reference
Kroon LP1, Bakker FT, van den Bosch GB, Bonants PJ and Flier WG (2004) Phylogenetic analysis of Phytophthora species based on mitochondrial and nuclear DNA sequences. Fungal Genetics and Biology 41: 766-782.
Literature
Xavier Giresse, Sophia Ahmed, Sylvie Richard-Cervera and Fran├žois Delmotte (2010) Development of New Oomycete Taxon-specific Mitochondrial Cytochrome b Region Primers for Use in Phylogenetic and Phylogeographic Studies. Journal of Phytopathology 158: 321-327.