PriMicro Database

For classification, identification and molecular phylogenetic analyses of microbes

Primer Detail

Primer name
Falpha2
Gene name
mating-type gene (MAT-1)
Primer sequence (5'-3')
GATGTAGATGGAGGGTTCAA
Direction
R
Reference
Hirano Y and Arie T (2009) Variation and phylogeny of Fusarium oxysporum isolates based on nucleotide sequences of polygalacturonase genes. Microbes Environments 24: 113-120.
Arie T, Kaneko I, Yoshida T, Noguchi M, Nomura Y and Yamaguchi I (2000) Mating-type genes from asexual phytopathogenic ascomycetes Fusarium oxysporum and Alternaria alternata. Molecular Plant-Microbe Interactions 13: 1330-1339.
Literature
Gerda Fourie, ET Steenkamp, TR Gordon and A Viljoen (2009) Evolutionary relationships among the Fusarium oxysporum f. sp. cubense vegetative compatibility groups. Applied and Environmental Microbiology 75: 4770-4781.
Michael J Southwood, Altus Viljoen, Lizel Mostert, Lindy J Rose and Adéle McLeod (2012) Phylogenetic and biological characterization of Fusarium oxysporum isolates associated with onion in south Africa. Plant Disease 96: 1250-1261.
Emma T Steenkamp, Brenda D Wingfield, Teresa A Coutinho, Kurt A Zeller, Michael J Wingfield, Walter FO Marasas and John F Leslie (2000) PCR-Based Identification of MAT-1 and MAT-2 in the Gibberella fujikuroi Species Complex. Applied and Environmental Microbiology 66: 4378-4382.
Kawabe M, Kobayashi Y, Okada G, Yamaguchi I, Teraoka T and Arie T (2005) Three evolutionary lineages of tomato wilt pathogen, Fusarium oxysporum f. sp. lycopersici, based on sequences of IGS, MAT1, and pg1, are each composed of isolates of a single mating type and a single or closely related vegetative compatibility group. Journal of General Plant Pathology 71: 263-272.
Reference Strain
Fusarium oxysporum f. sp. batatasMAFF 103070
Fusarium oxysporum f. sp. colocasiaeMAFF 744032, MAFF 744035
Fusarium oxysporum f. sp. conglutinansMAFF 727516, MAFF 744001
Fusarium oxysporum f. sp. cucumerinumMAFF 103054, MAFF 744005
Fusarium oxysporum f. sp. dianthiMAFF 103072, MAFF 305946
Fusarium oxysporum f. sp. fragariaeMAFF 305557, MAFF 727510, MAFF 744009
Fusarium oxysporum f. sp. lactucaeMAFF 744028, MAFF 744029
Fusarium oxysporum f. sp. lagenariaeMAFF 103008, MAFF 744002
Fusarium oxysporum f. sp. lycopersiciMAFF 103042, MAFF 103043, MAFF 103043, MAFF 305121, MAFF 305121, MAFF 305559, MAFF 727501, MAFF 727501, MAFF 744006, MAFF 744006
Fusarium oxysporum f. sp. lycopersici race 1MAFF 103036, MAFF 103036, MAFF 103036
Fusarium oxysporum f. sp. lycopersici race 2MAFF 103038, MAFF 103038, MAFF 103038
Fusarium oxysporum f. sp. melongenaeMAFF 103051, MAFF 103051, MAFF 103051
Fusarium oxysporum f. sp. melonisMAFF 305122, MAFF 305544
Fusarium oxysporum f. sp. niveumMAFF 305543, MAFF 305608, NBRC 9969
Fusarium oxysporum f. sp. phaseoliMAFF 235727, NBRC 9970
Fusarium oxysporum f. sp. radicis-lycopersiciMAFF 103044, MAFF 103044, MAFF 103044, MAFF 103047, MAFF 103047
Fusarium oxysporum f. sp. raphaniMAFF 103058, MAFF 305124
Fusarium oxysporum f. sp. spinaciaeMAFF 103059, MAFF 731044
Fusarium oxysporum f. sp. tracheiphilumMAFF 235725, MAFF 235726
Fusarium oxysporum f. sp. tulipaeMAFF 235105, MAFF 235109