Primer Detail
- Primer name
- DseptoMat1f
- Gene name
- (MAT1-1-1)
- Primer sequence (5'-3')
- CGCAGTAAGTGATGCCCTGAC
- Direction
- F
- Category
- specific primer
- Reference
- Groenewald M, Barnes I, Bradshaw RE, Brown AV, Dale A, Groenewald JZ, Lewis KJ, Wingfield BD, Wingfield MJ and Crous PW (2007) Characterization and distribution of mating type genes in the dothistroma needle blight pathogens. Phytopathology 97(7): 825-834.