Primer Detail
- Primer name
- CAL-737R
CAL737R - Gene name
- calmodulin (CAL)
- Primer sequence (5'-3')
- CATCTTTCTGGCCATCATGG
- Direction
- R
- Target
- filamentous ascomycetes
- Reference
- Carbone I, Kohn LM (1999) A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91: 553-556.
- Literature
- Crous PW, Groenewald JZ, Pongpanich K, Himaman W, Arzanlou M and Wingfield MJ (2004) Cryptic speciation and host specificity among Mycosphaerella spp. occurring on Australian Acacia species grown as exotics in the tropics. Studies in Mycology 50: 457-469.
- Avila de la Calle A, Groenewald JZ, Trapero A and Crous PW (2005) Characterization and epitypification of Pseudocercospora cladosporioides, the causal organism of Cercospora leaf spot of olives. Mycological Research 109(8): 881-888.
- Crous PW, Groenewald JZ, Risède J-M, Simoneau P and Hywel-Jones NL (2004) Calonectria species and their Cylindrocladium anamorphs: species with sphaeropedunculate vesicles. Studies in Mycology 50: 415-430.
- Pedro W Crous, Johannes Z Groenewald, Marizeth Groenewald, Pat Caldwell, Uwe Braun and Thomas C Harrington (2006) Species of Cercospora associated with grey leaf spot of maize. Studies in Mycology 55: 189-197.
- Groenewald JZ, Nakashima C, Nishikawa J, Shin HD, Park JH, Jama AN, Groenewald M, Braun U and Crous PW (2013) Species concepts in Cercospora: spotting the weeds among the roses. Studies in Mycology 75: 115-170.
- Groenewald M, Groenewald JZ and Crous PW (2005) Distinct species exist within the Cercospora apii morphotype. Phytopathology 95: 951-959.
- L Lombard, PW Crous, BD Wingfield and MJ Wingfield (2010) Phylogeny and systematics of the genus Calonectria. Studies in Mycology 66: 31-69.
- Amselem J, Cuomo CA, van Kan JA, Viaud M, Benito EP, Couloux A, Coutinho PM, de Vries RP, Dyer PS, Fillinger S, Fournier E, Gout L, Hahn M, Kohn L, Lapalu N, Plummer KM, Pradier JM, Quévillon E, Sharon A, Simon A, ten Have A, Tudzynski B, Tudzynski P, Wincker P, Andrew M, Anthouard V, Beever RE, Beffa R, Benoit I, Bouzid O, Brault B, Chen Z, Choquer M, Collémare J, Cotton P, Danchin EG, Da Silva C, Gautier A, Giraud C, Giraud T, Gonzalez C, Grossetete S, Güldener U, Henrissat B, Howlett BJ, Kodira C, Kretschmer M, Lappartient A, Leroch M, Levis C, Mauceli E, Neuvéglise C, Oeser B, Pearson M, Poulain J, Poussereau N, Quesneville H, Rascle C, Schumacher J, Ségurens B, Sexton A, Silva E, Sirven C, Soanes DM, Talbot NJ, Templeton M, Yandava C, Yarden O, Zeng Q, Rollins JA, Lebrun MH and Dickman M (2011) Genomic analysis of the necrotrophic fungal pathogens Sclerotinia sclerotiorum and Botrytis cinerea. PLoS Genetics 7: e1002230.
- Collado-Romero M, Mercado-Blanco J, Olivares-García C and Jiménez-Díaz RM (2008) Phylogenetic analysis of Verticillium dahliae vegetative compatibility groups. Phytopathology 98: 1019-1028.
- Reference Strain
Cercospora apii IMI 077043, IMI 161116, MAFF 235978, MAFF 238072, MAFF 238299 Cercospora begoniae MAFF 237690 Cercospora beticola MAFF 238206, MAFF 305036 Cercospora capsici MAFF 238227 Cercospora citrullina MAFF 237872, MAFF 237913, MAFF 238205 Cercospora corchori MAFF 238191 Cercospora ipomoeae MAFF 239409 Cercospora kikuchii MAFF 305039, MAFF 305040 Cercospora lactucae-sativae MAFF 237719, MAFF 238209 Cercospora psophocarpicola MAFF 305757 Cercospora richardiicola MAFF 238210 Cercospora vignigena MAFF 237635 Cercospora zinniae MAFF 237718 Lasiodiplodia theobromae MAFF 238880