Primer Detail
- Primer name
- MS1
- Gene name
- Mitochondrial small rRNA gene
- Primer sequence (5'-3')
- CAGCAGTCAAGAATATTAGTCAATG
- Direction
- F
- Target
- Fungi
- Reference
- White, T. J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, eds. Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White. Academic Press, Inc., New York. 315-322.
- Literature
- K N Li, D I Rouse, and T L Germa (1994) PCR primers that allow intergeneric differentiation of ascomycetes and their application to Verticillium spp.. Applied and Environmental Microbiology 60(12): 4324-4331.
- Zeng QY, Westermark SO, Rasmuson-Lestander A and Wang XR (2006) Detection and quantification of Cladosporium in aerosols by real-time PCR. Journal of Environmental Monitoring 8(1): 153-160.
- Gerda Fourie, ET Steenkamp, TR Gordon and A Viljoen (2009) Evolutionary relationships among the Fusarium oxysporum f. sp. cubense vegetative compatibility groups. Applied and Environmental Microbiology 75: 4770-4781.
- KM Webb, PA Covey and LE Hanson (2012) Pathogenic and phylogenetic analysis of Fusarium oxysporum from sugarbeet in Michigan and Minnesota. Journal of Sugar Beet Research 49: 38-56.
- O'Donnell K, Sutton DA, Rinaldi MG, Magnon KC, Cox PA, Revankar SG, Sanche S, Geiser DM, Juba JH, van Burik JA, Padhye A, Anaissie EJ, Francesconi A, Walsh TJ and Robinson JS (2004) Genetic diversity of human pathogenic members of the Fusarium oxysporum complex inferred from multilocus DNA sequence data and amplified fragment length polymorphism analyses: evidence for the recent dispersion of a geographically widespread clonal lineage and nosocomial origin. Journal of Clinical Microbiology 42: 5109-5120.