Primer Detail
- Primer name
- ITS5
nu-SSU-1766-5' - Gene name
- ITS1-5.8S-ITS2 rRNA gene (ITS)
- Primer sequence (5'-3')
- GGAAGTAAAAGTCGTAACAAGG
- Direction
- F
- Category
- universal primer
- Paired primer
- ITS4Asco ITS4Basidio ITS4Chytrid ITS4Oo ITS4Zygo LR5-Tom LR5-Seb LR3-Tul ITS4-Tul PINF
- Reference
- White, T. J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, eds. Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White. Academic Press, Inc., New York. 315-322.
- Literature
- Loretta M. Winton, Jeffrey K. Stone, Everett M. Hansen, R.A. Shoemaker (2007) The systematic position of Phaeocryptopus gaeumannii. Mycologia 99(2): 240-252.
- P.W. Crous, C.L. Schoch, K.D. Hyde, A.R. Wood, C. Gueidan, G.S. de Hoog and J.Z. Groenewald (2009) Phylogenetic lineages in the Capnodiales. Studies in Mycology 64: 17-47.
- Annette Kretzer, Yunan Li, Timothy Szaro and Thomas D. Bruns (1996) Internal transcribed spacer sequences from 38 recognized species of Suillus sensu lato: Phylogenetic and taxonomic implications. Mycologia 88(5): 776-785.
- K.A. Seifert, S.J. Hughes, H. Boulay and G. Louis-Seize (2007) Taxonomy, nomenclature and phylogeny of three cladosporium-like hyphomycetes, Sorocybe resinae, Seifertia azaleae and the Hormoconis anamorph of Amorphotheca resinae. Studies in Mycology 58: 235-245.
- Gargas, A. and DePriest, P. T. (1996) A nomenclature for fungal PCR primers with examples from intron-containing SSU rDNA. Mycologia 88: 745-748.
- Gargas, A. P.T. DePriest and J.W. Taylor (1995) Positions of multiple insertions in SSU rDNA of lichen-forming fungi. Molecular Biology and Evolution 12: 208-218.
- http://www.lutzonilab.net/primers/page244.shtml
- Tina C. Summefield and Julian J. Eaton-Rye (2006) Pseudocyphellaria crocata, P. neglecta and P. perpetua from the Northern and Southern Hemispheres are a phylogenetic species and share cyanobiont. New Phytologist 170: 597-607.
- Myllys, L., Lohtander, K. and Tehler, A (2001) β-tublin, ITS and group I intron sequences challenge the species pair concept in Physcia aipolia and P. caesia. Mycologia 93: 335-343.
- Leena Myllys, Katileena Lohtander, Mari Källersjö and Anders Tehler (1999) Sequence insertion and ITS data provide congruent information in Roccella canariensis and R. tuberculata (Arthoniales, Euascomycetes) phylogeny. Molecular Phylogenetics and Evolution 12: 295-309.
- Abarca GH, Ruiz RF, Mota RM, Hérnandez CI, Gómez S, Bogale M and Untereiner WA (2011) A new species of Heliocephala from Me´xico with an assessment of the systematic positions of the anamorph genera Heliocephala and Holubovaniella. Mycologia 103(3): 631-640.
- Larena I, Salazar O, González V, Julián MC and Rubio V (1999) Design of a primer for ribosomal DNA internal transcribed spacer with enhanced specificity for ascomycetes. Journal of Biotechnology 75: 187-194.
- BM Pryor, R Creamer, RA Shoemaker, J McLain-Romero, S Hambleton (2009) Undifilum, a new genus for endophytic Embellisia oxytropis and parasitic Helminthorporium bornmuelleri on legumes. Botany 87(2): 178-194.
- Tazick Z and Tajick Ghanbary MA (2013) Taxonomic position of Bipolaris oryzae among other Cochliobolus species using Ribosomal region and some Protein Coding genes. Research Journal of Recent Sciences 2: 212-216.
- Conrad L. Schocha, Keith A. Seifertb, Sabine Huhndorfc, Vincent Robertd, John L. Spougea, C. André Levesqueb, Wen Chenb and Fungal Barcoding Consortium (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences
- Collado J, Platas G, Paulus B and Bills GF (2007) High-throughput culturing of fungi from plant litter by a dilution-to-extinction technique. FEMS Microbiology Ecology 60(3): 521-533.
- Goodwin SB, Dunkle LD and Zismann VL (2011) Phylogenetic analysis of cercospora and mycosphaerella based on the internal transcribed spacer region of ribosomal DNA. Phytopathology 91(7): 648-658.
- Abliz P, Fukushima K, Takizawa K, Nieda N, Miyaji M and Nishimura K (2003) Rapid identification of the genus fonsecaea by PCR with specific oligonucleotide primers. Journal of Clinical Microbiology 41(2): 873-876.
- López-Villavicencio M, Aguileta G, Giraud T, de Vienne DM, Lacoste S, Couloux A and Dupont J (2010) Sex in Penicillium: combined phylogenetic and experimental approaches. Fungal Genetics and Biology 47: 693-706.
- AM Minnis, AH Kennedy, DB Grenier, ME Palm and AY Rossman (2012) Phylogeny and taxonomic revision of the Planistromellaceae including its coelomycetous anamorphs: contributions towards a monograph of the genus Kellermania. Persoonia 29: 11-28.
- M Réblová, W Gams and KA Seifert (2011) Monilochaetes and allied genera of the Glomerellales, and a reconsideration of families in the Microascales. Studies in Mycology 68: 163-191.
- Verkley GJ, Quaedvlieg W, Shin HD and Crous PW (2013) A new approach to species delimitation in Septoria. Studies in Mycology 75: 213-305.
- Quaedvlieg W, Verkley GJ, Shin HD, Barreto RW, Alfenas AC, Swart WJ, Groenewald JZ and Crous PW (2013) Sizing up Septoria. Studies in Mycology 75: 307-390.
- Groenewald JZ, Nakashima C, Nishikawa J, Shin HD, Park JH, Jama AN, Groenewald M, Braun U and Crous PW (2013) Species concepts in Cercospora: spotting the weeds among the roses. Studies in Mycology 75: 115-170.
- Verkley GJ, Starink-Willemse M, van Iperen A and Abeln EC (2004) Phylogenetic analyses of Septoria species based on the ITS and LSU-D2 regions of nuclear ribosomal DNA. Mycologia 96: 558-571.
- Quaedvlieg W, Groenewald JZ, Jesús Yáñez-Morales M and Crous PW (2012) DNA barcoding of Mycosphaerella species of quarantine importance to Europe. Persoonia 29: 101-115.
- Rehner SA and Buckley E (2005) A Beauveria phylogeny inferred from nuclear ITS and EF1-a sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 97: 84-98.
- Su'udi M, Park JM, Kang WR, Hwang DJ, Kim S and Ahn IP (2013) Quantification of rice sheath blight progression caused by Rhizoctonia solani. Journal of Microbiology 51: 380-388.
- Schena L, Nigro F and Ippolito A (2002) Identification and detection of Rosellinia necatrix by conventional and real-time Scorpion-PCR. European Journal of Plant Pathology 108: 355-366.
- L Schena and A Ippolito (2003) Rapid and sensitive detection of Rosellinia necatrix in roots and soils by real time scorpion-PCR. Journal of Plant Pathology 85: 15-25.
- Freeman J, Ward E, Calderon C and McCartney A (2002) A polymerase chain reaction (PCR) assay for the detection of inoculum of Sclerotinia sclerotiorum. European Journal of Plant Pathology 108: 877-886.
- Toyozo Sato and Jouji Moriwaki (2013) Molecular re-identification of strains in NIAS Genebank belonging to phylogenetic groups A2 and A4 of the Colletotrichum acutatum species complex. Microbiology and Culture Collections 29: 13-23.
- Yan-Yan Long, Xin Sun, Ji-Guang Wei, Xiang Sun, Ji-Jing Wei, Hui Deng and Liang-Dong Guo (2014) Two new species, Pythium agreste and P . wuhanense, based on morphological characteristics and DNA sequence data. Mycological Progress 13: 145-155.
- Toju H, Tanabe AS, Yamamoto S and Sato H (2012) High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples. PLoS One 6: e40863.
- Leho Tederso, Teele Jairus, Bryony M Horton, Kessy Abarenkov, Triin Suvi, Irja Saar and Urmas Kõljalg (2008) Strong host preference of ectomycorrhizal fungi in a Tasmanian wet sclerophyll forest as revealed by DNA barcoding and taxon-specific primers. New Phytologist 180: 479-490.
- Kawamura Y, Yokoo K, Tojo M and Hishiike M (2005) Distribution of Pythium porphyrae, the Causal Agent of Red Rot Disease of Porphyrae spp., in the Ariake Sea, Japan. Plant Disease 89: 1041-1047.
- CL Trout, JB Ristaino, M Madritch and T Wangsomboondee (1997) Rapid detection of Phytophthora infestans in Late blight-infected potato and tomato using PCR. Plant Disease 81: 1042-1048.
- Judelson HS and Tooley PW. (2000) Enhanced polymerase chain reaction methods for detecting and quantifying Phytophthora infestans in plants. Phytopathology 90: 1112-1119.
- Kerry O’Donnell, Deanna A Sutton, Annette Fothergill, Dora McCarthy, Michael G Rinaldi, Mary E Brandt, Ning Zhang and David M Geiser (2008) Molecular phylogenetic diversity, multilocus haplotype nomenclature, and in vitro antifungal Rresistance within the Fusarium solani species complex. Journal of Clinical Microbiology 46: 2477-2490.
- Reference Strain
Alternaria alternata IFM 41348 Aureobasidium pullulans IFM 4802 Candida albicans IFM 40214 Candida dubliniensis IFM 48313 Candida glabrata IFM 46888 Candida parapsilosis IFM 46863 Candida tropicalis IFM 46816 Cercospora apii IMI 077043, IMI 161116, MAFF 235978, MAFF 238072, MAFF 238299 Cercospora begoniae MAFF 237690 Cercospora beticola MAFF 238206, MAFF 305036 Cercospora capsici MAFF 238227 Cercospora citrullina MAFF 237872, MAFF 237913, MAFF 238205 Cercospora corchori MAFF 238191 Cercospora ipomoeae MAFF 239409 Cercospora kikuchii MAFF 305039, MAFF 305040 Cercospora lactucae-sativae MAFF 237719, MAFF 238209 Cercospora psophocarpicola MAFF 305757 Cercospora richardiicola MAFF 238210 Cercospora vignigena MAFF 237635 Cercospora zinniae MAFF 237718 Cladophialophora bantiana IFM 46165 Cladophialophora carrionii IFM 4805, IFM 4810, IFM 4812, IFM 41444, IFM 41446, IFM 41641 Cladophialophora devriesii IFM 51369 Cladophialophora minourae IFM 4841 Cladosporium cladosporioides IFM 41447, IFO 6368 Cladosporium colocasiae IFM 51371 Cladosporium coralloides IFM 41451, IFO 6536 Cladosporium elatum IFM 41452, IFO 6372 Cladosporium fulvum IFM 40703 Cladosporium herbarum IFM 41454 Cladosporium minusculum IFM 51370 Cladosporium resinae f. sp. avellaneum IFM 41456, IFO 6367 Cladosporium sphaerospermum IFM 41453, IFO 4458 Cladosporium variabile IFM 41458, IFO 6378 Colletotrichum acutatum MAFF 238555, MAFF 744062, MAFF 744063 Colletotrichum carthami MAFF 239356, MAFF 239357, MAFF 239358, MAFF 239359, MAFF 239360, MAFF 239361, MAFF 239362, MAFF 239364, MAFF 239365, MAFF 239366, MAFF 239367, MAFF 239368, MAFF 239369, MAFF 239370, MAFF 239371, MAFF 239372, MAFF 239373, MAFF 239374 Colletotrichum godetiae MAFF 240289, MAFF 241295, MAFF 241296, MAFF 241297, MAFF 306506 Colletotrichum nymphaeae MAFF 239773, MAFF 241261, MAFF 241294, MAFF 242413, MAFF 242414, MAFF 242415, MAFF 242416, MAFF 242417, MAFF 242418, MAFF 242419, MAFF 242581, MAFF 242590, MAFF 306406, MAFF 306407, MAFF 306430, MAFF 306487, MAFF 306488, MAFF 306503, MAFF 306505 Colletotrichum scovillei MAFF 242420, MAFF 242421, MAFF 242422, MAFF 242425, MAFF 242426, MAFF 242427, MAFF 242428, MAFF 242592, MAFF 242692, MAFF 242693, MAFF 243021, MAFF 243022, MAFF 243038 Colletotrichum sloanei MAFF 239736 Colletotrichum sp.(B) MAFF 237894, MAFF 306172 Colletotrichum sp.(C) MAFF 240237 Colletotrichum sp.(J) MAFF 237922, MAFF 306725, MAFF 306726, MAFF 410809 Cryptococcus neoformans var. neoformans IFM 40216 Exophiala alcalophila IFM 41654 Exophiala dermatitidis IFM 41479, IFM 41818, IFM 41828, IFM 45986 Exophiala jeanselmei IFM 41691, IFM 45989 Exophiala moniliae IFM 41500 Exophiala spinifera IFM 4883 Fonsecaea compacta IFM 4886, IFM 41704, IFM 41931 Fonsecaea pedrosoi IFM 4856, IFM 4887, IFM 4889, IFM 4890, IFM 4892, IFM 4894, IFM 4896, IFM 4898, IFM 4914, IFM 4915 Hormoconis resinae IFM 51372, IFO 8588 Hortaea werneckii IFM 51373 Lasiodiplodia theobromae MAFF 238880 Lecanosticta acicola IMI 281598 Lecythophora ho¡mannii IFM 4922 Lecythophora mutabilis IFM 4923 Malassezia furfur IFM 48585 Phaeoacremonium parasiticum IFM 4924 Phialophora alba IFM 51363, IFO 31973 Phialophora americana IFM 51361 Phialophora atrovirens IFM 51364, IFO 6793 Phialophora bubakii IFM 51365, IFO 6794 Phialophora cinerescens IFM 51366, IFO 6849 Phialophora fastigiata IFM 41577, IFO 6856 Phialophora heteromorpha IFM 41578, IFO 6878 Phialophora lagerbergii IFM 51367, IFO 8576 Phialophora melinii IFM 51362 Phialophora oxyspora IFM 51368 Phialophora repens IFM 4925 Phialophora richardsiae IFM 4926 Phialophora verrucosa IFM 4928, IFM 41710, IFM 41871, IFM 41873, IFM 41879 Rhinocladiella aquaspersa IFM 4930 Rhinocladiella atrovirens IFM 4931 Trichosporon asahii var. asahii IFM 48429